RJ - Instituto Oswaldo Cruz

Endereço

Avenida Brasil 4365, - Manguinhos, Rio de Janeiro CEP: 21040900

Sequenciamento de Nova Geração - MiSeq
A Plataforma de nova geração Illumina MiSeq oferece preparação e/ou análise de bibliotecas de sequenciamento para aplicações de RNAseq, sequenciamento genômico, metagenômica e amplicons nos formatos single-end e pair-end. O MiSeq apresenta throughput que varia de 540 Mb a 15 Gb e 25 milhões de reads.
Serviços oferecidos
  • P01-012Q : Construção de bibliotecas ILLUMINA Strnd mRNA Clique para a descrição do serviço oferecido

    O processo de preparação de bibliotecas utilizando o kit ILLUMINA Stranded mRNA envolve a quantificação das amostras de RNA (Qubit), qualificação das amostras de RNA (Tape Station), preparação das bibliotecas, quantificação das bibliotecas (Qubit), qualificação das bibliotecas (Tape Station 1000) e a junção das bibliotecas para o sequenciamento. O sequenciamento é um serviço a parte e não está incluído neste processo.

    O material biológico deve obedecer as seguintes condições:

    - A massa de RNA Total necessária para a preparação das bibliotecas é de 100ng a1ug;

    - No caso de iniciar a preparação das bibliotecas utilizando mRNA, o mesmo deverá ser obtido a partir de 1ug de RNA Total.

    - O RNA deve estar íntegro apresentando um valor de integridade > 7 (RIN TapeStation);

    - O fracionamento do RNA no Tape Station faz parte do processo de avaliação de qualidade incluído no serviço

    Você precisa estar logado para opções de contratação

    Sob consulta

  • P01-012R : Construção de bibliotecas ILLUMINA Strnd Total RNA Clique para a descrição do serviço oferecido

    O processo de preparação de bibliotecas utilizando o kit ILLUMINA Stranded mRNA envolve a quantificação das amostras de RNA (Qubit), qualificação das amostras de RNA (Tape Station), preparação das bibliotecas, quantificação das bibliotecas (Qubit), qualificação das bibliotecas (Tape Station 1000) e a junção das bibliotecas para o sequenciamento. O sequenciamento é um serviço a parte e não está incluído neste processo.

    O material biológico deve obedecer as seguintes condições:

    - A massa de RNA Total necessária para a preparação das bibliotecas é de 100ng a1ug;

    - O RNA deve estar íntegro apresentando um valor de integridade > 7 (RIN TapeStation);

    - O fracionamento do RNA no Tape Station faz parte do processo de avaliação de qualidade incluído no serviço

    Você precisa estar logado para opções de contratação

    Sob consulta

  • P01-012P : MiSeq: Leitura de bibliotecas individuais, kit v2 300 ciclos Clique para a descrição do serviço oferecido

    Corrida MiSeq contendo de 1 a 384 amostras.

    Paired-end 2 x 150 bp.

    Você precisa estar logado para opções de contratação

    Sob consulta

  • P01-012O : Construção de bibliotecas Nextera XT DNA Clique para a descrição do serviço oferecido

    O processo de preparação de bibliotecas utilizando o kit Nextera XT envolve a quantificação das amostras (Qubit), construção das bibliotecas, quantificação das bibliotecas (Qubit), qualificação das bibliotecas (TapeStation) e agrupamento das bibliotecas para o sequenciamento. O sequenciamento é um serviço a parte e não está incluído neste processo.

    O material biológico deve obedecer as seguintes condições:

    - A massa de gDNA íntegro necessária para genomas pequenos é de 1ng.

    Você precisa estar logado para opções de contratação

    Sob consulta

  • P01-012A : Construção de bibliotecas de Nextera DNA Flex Clique para a descrição do serviço oferecido

    O processo de preparação de bibliotecas utilizando o kit Nextera DNA Flex envolve a quantificação das amostras (Qubit), construção das bibliotecas, quantificação das bibliotecas (Qubit), qualificação das bibliotecas (TapeStation 1000) e agrupamento das bibliotecas para o sequenciamento. O sequenciamento é um serviço a parte e não está incluído neste processo.

    O material biológico deve obedecer as seguintes condições:

    - A massa de gDNA íntegro necessária para genomas pequenos é de 500ng;

    - A massa de gDNA íntegro necessária para genomas grandes e complexos é de 1ug;

    - A integridade do gDNA deve ser registrada através de gel de agarose e encaminhada para avaliação.

    Você precisa estar logado para opções de contratação

    Sob consulta

  • P01-012B : Construção de bibliotecas Amplicon Clique para a descrição do serviço oferecido

    O usuário deve entregar o produto amplificado com iniciadores específicos para a região de interesse acoplados à sequência do adaptador Illumina como descrito abaixo:

    Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG?[locusspecific sequence]

    Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG?[locusspecific sequence]

    Você precisa estar logado para opções de contratação

    Sob consulta

  • P01-012C : Construção de bibliotecas de TruSeq Stranded mRNA Clique para a descrição do serviço oferecido

    O processo de preparação de bibliotecas utilizando o kit TruSeq Stranded mRNA envolve a quantificação das amostras de RNA (Qubit), qualificação das amostras de RNA (Tape Station), preparação das bibliotecas, quantificação das bibliotecas (Qubit), qualificação das bibliotecas (Tape Station 1000) e a junção das bibliotecas para o sequenciamento. O sequenciamento é um serviço a parte e não está incluído neste processo.

    O material biológico deve obedecer as seguintes condições:

    - A massa de RNA Total necessária para a preparação das bibliotecas é de 3ug;

    - No caso de iniciar a preparação das bibliotecas utilizando mRNA, o mesmo deverá ser obtido a partir de 1 a 4 ug de RNA Total.

    - O RNA deve estar íntegro apresentando um valor de integridade > 8 (RIN TapeStation);

    - O fracionamento do RNA no Tape Station faz parte do processo de avaliação de qualidade incluído no serviço

    Você precisa estar logado para opções de contratação

    Sob consulta

  • P01-012D : Construção de bibliotecas de TruSeq Stranded Total RNA Clique para a descrição do serviço oferecido

    O processo de preparação de bibliotecas utilizando o kit TruSeq Stranded Total RNA envolve a quantificação das amostras de RNA (Qubit), qualificação das amostras de RNA (TapeStation 1000), depleção do rRNA, preparação das bibliotecas, quantificação das bibliotecas (Qubit), qualificação das bibliotecas (TapeStation 1000) e a junção das bibliotecas para o sequenciamento. O sequenciamento é um serviço a parte e não está incluído neste processo.

    O material biológico deve obedecer as seguintes condições:

    - A massa de RNA Total necessária para a preparação das bibliotecas é de 3ug;

    - O RNA deve estar íntegro apresentando um valor de integridade > 8 (TapeStation);

    - O fracionamento do RNA no TapeStation faz parte do processo de avaliação de qualidade incluído no serviço.

     

    Você precisa estar logado para opções de contratação

    Sob consulta

  • P01-012E : Construção de bibliotecas de TruSeq RNA Clique para a descrição do serviço oferecido

    O processo de preparação de bibliotecas utilizando o kit TruSeq RNA envolve a quantificação das amostras de RNA (Qubit), qualificação das amostras de RNA (TapeStation 1000), preparação das bibliotecas, quantificação das bibliotecas (Qubit), qualificação das bibliotecas (TapeStation 1000) e a junção das bibliotecas para o sequenciamento. O sequenciamento é um serviço a parte e não está incluído neste processo.

    Este kit permite a que o rRNA seja depletado utilizando um kit de depleção de RNA ribossomal ou enriquecimento para polyA.

    O material biológico deve obedecer as seguintes condições:

    - A massa de RNA Total necessária para a preparação das bibliotecas é de 3 ug;

    - No caso de iniciar a preparação das bibliotecas utilizando mRNA, o mesmo deverá ser obtido a partir de 1 a 4 ug de RNA Total.

    - O RNA deve estar íntegro apresentando um valor de integridade > 8 (TapeStation 1000);

    - O fracionamento do RNA no TapeStation faz parte do processo de avaliação de qualidade incluído no serviço

    Você precisa estar logado para opções de contratação

    Sob consulta

  • P01-012F : Preparação de bibliotecas outras tecnologias Clique para a descrição do serviço oferecido

    Este serviço necessita ser previamente combinado com a plataforma.

    Condição de amostras: DNA, RNA ou amplicons purifcados e eluídos em água ultra pura. A massa necessária será definida de acordo com o protocolo definido.

    Você precisa estar logado para opções de contratação

    Sob consulta

  • P01-012G : MiSeq: Leitura de bibliotecas individuais, kit v3 150 ciclos Clique para a descrição do serviço oferecido

    Corrida MiSeq contendo de 1 a 96 amostras.

    Paired-end 2 x 75 bp.

    Você precisa estar logado para opções de contratação

    Sob consulta

  • P01-012H : MiSeq: Leitura de bibliotecas individuais, kit v2 500 ciclos Clique para a descrição do serviço oferecido

    Corrida MiSeq contendo de 1 a 96 amostras.

    Paired-end 2 x 250 bp.

    Você precisa estar logado para opções de contratação

    Sob consulta

  • P01-012I : MiSeq: Leitura de bibliotecas individuais, kit v3 600 ciclos Clique para a descrição do serviço oferecido

    Corrida MiSeq contendo de 1 a 384 amostras.

    Paired-end 2 x 300 bp.

    Você precisa estar logado para opções de contratação

    Sob consulta

  • P01-012L : Treinamento Clique para a descrição do serviço oferecido
    Você precisa estar logado para opções de contratação

    Indisponível no momento
  • P01-012M : Consultoria Clique para a descrição do serviço oferecido
    Você precisa estar logado para opções de contratação

    Sob consulta