MG - Instituto René Rachou

Endereço

Augusto de Lima, 1715 - Barro Preto, Belo Horizonte CEP: 30190009

Sequenciador de Nova Geração - MiSeq
A Plataforma de nova geração Illumina MiSeq oferece preparação e/ou análise de bibliotecas de sequenciamento para aplicações de RNAseq, sequenciamento genômico, metagenômica e amplicons nos formatos single-end e pair-end. O MiSeq apresenta throughput que varia de 540 Mb a 15 Gb e 25 milhões de reads.
Serviços oferecidos
  • P01-007K : Bioanalyzer DNA 1000 Clique para a descrição do serviço oferecido

    A biblioteca de DNA deverá estar na concentração de 30ng/ul.

    Cada chip tem a capacidade máxima de 12 amostras.

     

     

    Você precisa estar logado para preço e opção de contratação
  • P01-007L : Bioanalyzer High Sensitivity DNA Clique para a descrição do serviço oferecido

    A biblioteca de DNA deverá estar na concentração de 5ng/ul.

    Cada chip tem a capacidade máxima de 11 amostras.

    Você precisa estar logado para preço e opção de contratação
  • P01-007A : Construção de bibliotecas de Nextera DNA Flex Requer capacitação prévia Clique para a descrição do serviço oferecido

    - A massa de gDNA íntegro necessária para genomas pequenos é de 500ng;

    - A massa de gDNA íntegro necessária para genomas grandes e complexos é de1ug;

    - A integridade do gDNA deve ser registrada através de gel de agarose.

    Você precisa estar logado para preço e opção de contratação
  • P01-007B : Construção de bibliotecas Amplicon Requer capacitação prévia Clique para a descrição do serviço oferecido

    O usuário deve entregar o produto amplificado com iniciadores espeíficos para a região de interesse acoplados à sequência do adaptador Illumina como descrito abaixo:

    Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG?[locusspecific sequence]

    Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG?[locusspecific sequence]

    Você precisa estar logado para preço e opção de contratação
  • P01-007C : Construção de bibliotecas de TruSeq Stranded mRNA Clique para a descrição do serviço oferecido
    Você precisa estar logado para preço e opção de contratação
  • P01-007D : Construção de bibliotecas de TruSeq Stranded Total RNA Clique para a descrição do serviço oferecido
    Você precisa estar logado para preço e opção de contratação
  • P01-007E : Construção de bibliotecas de TruSeq RNA Clique para a descrição do serviço oferecido
    Você precisa estar logado para preço e opção de contratação
  • P01-007F : Corrida 500 ciclos Requer capacitação prévia Clique para a descrição do serviço oferecido

    Corrida MiSeq contendo de 1 a 96 amostras.

    Você precisa estar logado para preço e opção de contratação
  • P01-007G : Corrida 600 ciclos Requer capacitação prévia Clique para a descrição do serviço oferecido

    Corrida MiSeq contendo de 1 a 96 amostras.

    Você precisa estar logado para preço e opção de contratação
  • P01-007H : Bioanalyzer RNA 6000 Pico Clique para a descrição do serviço oferecido

    O RNA deverá estar na concentração de 10ng/ul.

    Cada chip tem a capacidade máxima de 11 amostras.

    Você precisa estar logado para preço e opção de contratação
  • P01-007I : Qubit RNA HS, RNA BR, dsDNA HS ou dsDNA BR Clique para a descrição do serviço oferecido

    O equipamento tem capacidade de leitura para 1 amostra por vez.

    Serão necessários 2,0 ul de amostra para a quantificação.

    Será necessário a leitura dos padrões será realizada para todas os blocos de amostras a serem quantificadas.

    Você precisa estar logado para preço e opção de contratação
  • P01-007J : Consultoria Clique para a descrição do serviço oferecido
    Você precisa estar logado para preço e opção de contratação