MG - Instituto René Rachou

Endereço

Augusto de Lima, 1715 - Barro Preto, Belo Horizonte CEP: 30190009

Sequenciador de Nova Geração - MiSeq
A Plataforma de nova geração Illumina MiSeq oferece preparação e/ou análise de bibliotecas de sequenciamento para aplicações de RNAseq, sequenciamento genômico, metagenômica e amplicons nos formatos single-end e pair-end. O MiSeq apresenta throughput que varia de 540 Mb a 15 Gb e 25 milhões de reads.
Serviços oferecidos
  • P01-007K : Bioanalyzer DNA 1000 Clique para a descrição do serviço oferecido

    A biblioteca de DNA ou RNA deverá estar na concentração aproximada de 30ng/ul.

    Cada chip tem a capacidade máxima de 12 amostras.

    Caso o número de amostras seja menor que a capacidade do kit e o usuário não puder esperar outras amostras para completar o chip, será cobrado o valor integral do chip (12 amostras).

     

     

    Você precisa estar logado para preço e opção de contratação
  • P01-007L : Bioanalyzer High Sensitivity DNA Clique para a descrição do serviço oferecido

    A biblioteca de DNA ou RNA deverá estar na concentração aproximada de 5ng/ul.

    Cada chip tem a capacidade máxima de 11 amostras.

    Caso o número de amostras seja menor que a capacidade do kit e o usuário não puder esperar outras amostras para completar o chip, será cobrado o valor integral do chip (11 amostras).

    Você precisa estar logado para preço e opção de contratação
  • P01-007A : Construção de bibliotecas de Nextera DNA Flex Requer capacitação prévia Clique para a descrição do serviço oferecido

    O processo de preparação de bibliotecas utilizando o kit Nextera DNA Flex envolve a quantificação das amostras (Qubit), construção das bibliotecas, quantificação das bibliotecas (Qubit), qualificação das bibliotecas (Bioanalyzer 1000) e agrupamento das bibliotecas para o sequenciamento. O sequenciamento é um serviço a parte e não está incluído neste processo.

    O material biológico deve obedecer as seguintes condições:

    - A massa de gDNA íntegro necessária para genomas pequenos é de 500ng;

    - A massa de gDNA íntegro necessária para genomas grandes e complexos é de 1ug;

    - A integridade do gDNA deve ser registrada através de gel de agarose e encaminhada para avaliação.

    Você precisa estar logado para preço e opção de contratação
  • P01-007B : Construção de bibliotecas Amplicon Requer capacitação prévia Clique para a descrição do serviço oferecido

    O usuário deve entregar o produto amplificado com iniciadores espeíficos para a região de interesse acoplados à sequência do adaptador Illumina como descrito abaixo:

    Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG?[locusspecific sequence]

    Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG?[locusspecific sequence]

     

    Você precisa estar logado para preço e opção de contratação
  • P01-007C : Construção de bibliotecas de TruSeq Stranded mRNA Requer capacitação prévia Clique para a descrição do serviço oferecido

    O processo de preparação de bibliotecas utilizando o kit TruSeq Stranded mRNA envolve a quantificação das amostras de RNA (Qubit), qualificação das amostras de RNA (Bioanalyzer 1000), preparação das bibliotecas, quantificação das bibliotecas (Qubit), qualificação das bibliotecas (Bioanalyzer 1000) e a junção das bibliotecas para o sequenciamento. O sequenciamento é um serviço a parte e não está incluído neste processo.

    O material biológico deve obedecer as seguintes condições:

    - A massa de RNA Total necessária para a preparação das bibliotecas é de 3ug;

    - No caso de iniciar a preparação das bibliotecas utilizando mRNA, o mesmo deverá ser obtido a partir de 1 a 4 ug de RNA Total.

    - O RNA deve estar íntegro apresentando um valor de integridade > 8 (RIN Bioanalyzer);

    - O fracionamento do RNA no Bioanalyzer faz parte do processo de avaliação de qualidade incluído no serviço.

    Você precisa estar logado para preço e opção de contratação
  • P01-007D : Construção de bibliotecas de TruSeq Stranded Total RNA Requer capacitação prévia Clique para a descrição do serviço oferecido

    O processo de preparação de bibliotecas utilizando o kit TruSeq Stranded Total RNA envolve a quantificação das amostras de RNA (Qubit), qualificação das amostras de RNA (Bioanalyzer 1000), depleção do rRNA, preparação das bibliotecas, quantificação das bibliotecas (Qubit), qualificação das bibliotecas (Bioanalyzer 1000) e a junção das bibliotecas para o sequenciamento. O sequenciamento é um serviço a parte e não está incluído neste processo.

    O material biológico deve obedecer as seguintes condições:

    - A massa de RNA Total necessária para a preparação das bibliotecas é de 3ug;

    - O RNA deve estar íntegro apresentando um valor de integridade > 8 (RIN Bioanalyzer);

    - O fracionamento do RNA no Bioanalyzer faz parte do processo de avaliação de qualidade incluído no serviço.

    Você precisa estar logado para preço e opção de contratação
  • P01-007E : Construção de bibliotecas de TruSeq RNA Clique para a descrição do serviço oferecido

    O processo de preparação de bibliotecas utilizando o kit TruSeq RNA envolve a quantificação das amostras de RNA (Qubit), qualificação das amostras de RNA (Bioanalyzer 1000), preparação das bibliotecas, quantificação das bibliotecas (Qubit), qualificação das bibliotecas (Bioanalyzer 1000) e a junção das bibliotecas para o sequenciamento. O sequenciamento é um serviço a parte e não está incluído neste processo.

    Este kit permite a que o rRNA seja depletado utilizando um kit de depleção de RNA ribossomal ou enriquecimento para polyA.

    O material biológico deve obedecer as seguintes condições:

    - A massa de RNA Total necessária para a preparação das bibliotecas é de 3 ug;

    - No caso de iniciar a preparação das bibliotecas utilizando mRNA, o mesmo deverá ser obtido a partir de 1 a 4 ug de RNA Total.

    - O RNA deve estar íntegro apresentando um valor de integridade > 8 (RIN Bioanalyzer);

    - O fracionamento do RNA no Bioanalyzer faz parte do processo de avaliação de qualidade incluído no serviço.

    Você precisa estar logado para preço e opção de contratação
  • P01-007F : Corrida 500 ciclos Requer capacitação prévia Clique para a descrição do serviço oferecido

    Corrida MiSeq contendo de 1 a 96 amostras.

    Paired-end 2 x 250 bp.

    Você precisa estar logado para preço e opção de contratação
  • P01-007G : Corrida 600 ciclos Requer capacitação prévia Clique para a descrição do serviço oferecido

    Corrida MiSeq contendo de 1 a 96 amostras.

    Paired-end 2 x 300 bp.

    Você precisa estar logado para preço e opção de contratação
  • P01-007H : Bioanalyzer RNA 6000 Pico Clique para a descrição do serviço oferecido

    O RNA total ou mRNA deverá estar na concentração aproximada de 10ng/ul.

    Cada chip tem a capacidade máxima de 11 amostras.

    Caso o número de amostras seja menor que a capacidade do kit e o usuário não puder esperar outras amostras para completar o chip, será cobrado o valor integral do chip (11 amostras).

    Você precisa estar logado para preço e opção de contratação
  • P01-007I : Qubit RNA HS, RNA BR, dsDNA HS ou dsDNA BR Clique para a descrição do serviço oferecido

    O equipamento tem capacidade de leitura de 1 amostra por vez.

    Serão necessários 3,0 ul de amostra para a quantificação.

    A leitura dos padrões será realizada por blocos de amostras a serem quantificadas.

    Você precisa estar logado para preço e opção de contratação
  • P01-007J : Consultoria Clique para a descrição do serviço oferecido
    Você precisa estar logado para preço e opção de contratação